pspax2 dna Search Results


resource source identifier recombinant dna plasmid pet15b lab stock n a plasmid pspax2 lab stock n a plasmid pmd2 g lab stock n a experimental models  (ATCC)
93
ATCC resource source identifier recombinant dna plasmid pet15b lab stock n a plasmid pspax2 lab stock n a plasmid pmd2 g lab stock n a experimental models
Resource Source Identifier Recombinant Dna Plasmid Pet15b Lab Stock N A Plasmid Pspax2 Lab Stock N A Plasmid Pmd2 G Lab Stock N A Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/DNA+plasmid/pm39541945-232-2-28
Average 93 stars, based on 1 article reviews
resource source identifier recombinant dna plasmid pet15b lab stock n a plasmid pspax2 lab stock n a plasmid pmd2 g lab stock n a experimental models - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
plasmid dna  (Addgene inc)
98
Addgene inc plasmid dna
Plasmid Dna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/psPAX2+(Plasmid+%2312260)/pmc11898276-170-6-12
Average 98 stars, based on 1 article reviews
plasmid dna - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier
crispr plasmid dna  (ATCC)
96
ATCC crispr plasmid dna
Figure 1 Schematic outline of the knockout process. The procedure includes (1) choosing a knockout strategy; (2) selecting gRNA target sites and performing vector cloning (Support Pro- tocols 1–3, Basic Protocol 1); (3) introducing <t>CRISPR</t> plasmids by transfection or transduction (Basic Protocols 2–5); (4) isolation and expansion of single-cell clones (Basic Protocol 6, Alternate Protocol 1); and (5) knockout verification by western blot analysis, PCR, and/or Sanger sequencing (Support Protocol 4, Basic Protocols 7–9).
Crispr Plasmid Dna, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/Plasmid+DNA/pm31503414-138-4-2
Average 96 stars, based on 1 article reviews
crispr plasmid dna - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
g0345 pspax2 addgene  (Addgene inc)
98
Addgene inc g0345 pspax2 addgene
KEY RESOURCES TABLE
G0345 Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/pMD2%2EG+(Plasmid+%2312259)/pmc07266008-1112-151-153
Average 98 stars, based on 1 article reviews
g0345 pspax2 addgene - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier
pspax2 vector dna  (Addgene inc)
93
Addgene inc pspax2 vector dna
KEY RESOURCES TABLE
Pspax2 Vector Dna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/6379+H10-K218T+(Plasmid+%231250)/pmc09085742-164-27-30
Average 93 stars, based on 1 article reviews
pspax2 vector dna - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
plasmid dna  (Thermo Fisher)
99
Thermo Fisher plasmid dna
KEY RESOURCES TABLE
Plasmid Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/DNA/pm23403278-28-11-20
Average 99 stars, based on 1 article reviews
plasmid dna - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
gene exp prodh2 mm00457662 m1  (Thermo Fisher)
91
Thermo Fisher gene exp prodh2 mm00457662 m1
KEY RESOURCES TABLE
Gene Exp Prodh2 Mm00457662 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/Gene+Exp%2E+Prodh2%2C+Mm00457662_m1/pm35276062-309-128-10
Average 91 stars, based on 1 article reviews
gene exp prodh2 mm00457662 m1 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier
pspax2  (Addgene inc)
96
Addgene inc pspax2
KEY RESOURCES TABLE
Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/pCMV-VSV-G+(Plasmid+%238454)/pmc06028316-126-23-24
Average 96 stars, based on 1 article reviews
pspax2 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
recombinant dna reagent atf4  (Addgene inc)
93
Addgene inc recombinant dna reagent atf4
Figure 4. Use of activating transcription factor 4 <t>(ATF4)</t> knockout cells and a rapamycin-resistant ATF4 to validate ATF4 targets regulated by mechanistic target of rapamycin complex 1 signaling. (A) Schematic of ATF4 transcript, including upstream open reading frames (uORFs), coding sequence (CDS), and <t>DNA-binding</t> domain (DNABD), highlighting location of CRISPRn guides biallelic location of ATF4 mutations generated in Tsc2-/-
Recombinant Dna Reagent Atf4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/ATF4+1%3A+Mouse+ATF4+(CHOP11%2FcATF)-WT+(Plasmid+%2321845)/10__7554_slash_elife__63326-275-110-118
Average 93 stars, based on 1 article reviews
recombinant dna reagent atf4 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
gene exp hnf4a hs00230853 m1  (Thermo Fisher)
98
Thermo Fisher gene exp hnf4a hs00230853 m1
Figure 4. Use of activating transcription factor 4 <t>(ATF4)</t> knockout cells and a rapamycin-resistant ATF4 to validate ATF4 targets regulated by mechanistic target of rapamycin complex 1 signaling. (A) Schematic of ATF4 transcript, including upstream open reading frames (uORFs), coding sequence (CDS), and <t>DNA-binding</t> domain (DNABD), highlighting location of CRISPRn guides biallelic location of ATF4 mutations generated in Tsc2-/-
Gene Exp Hnf4a Hs00230853 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/Gene+Exp%2E+HNF4A%2C+Hs00230853_m1/pm35474871-188-12-10
Average 98 stars, based on 1 article reviews
gene exp hnf4a hs00230853 m1 - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier
dna plasmids  (Addgene inc)
94
Addgene inc dna plasmids
Figure 4. Use of activating transcription factor 4 <t>(ATF4)</t> knockout cells and a rapamycin-resistant ATF4 to validate ATF4 targets regulated by mechanistic target of rapamycin complex 1 signaling. (A) Schematic of ATF4 transcript, including upstream open reading frames (uORFs), coding sequence (CDS), and <t>DNA-binding</t> domain (DNABD), highlighting location of CRISPRn guides biallelic location of ATF4 mutations generated in Tsc2-/-
Dna Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+dna/pBT100%2E106b+(Plasmid+%23122601)/bio_rxiv__738443-308-8-13
Average 94 stars, based on 1 article reviews
dna plasmids - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


Figure 1 Schematic outline of the knockout process. The procedure includes (1) choosing a knockout strategy; (2) selecting gRNA target sites and performing vector cloning (Support Pro- tocols 1–3, Basic Protocol 1); (3) introducing CRISPR plasmids by transfection or transduction (Basic Protocols 2–5); (4) isolation and expansion of single-cell clones (Basic Protocol 6, Alternate Protocol 1); and (5) knockout verification by western blot analysis, PCR, and/or Sanger sequencing (Support Protocol 4, Basic Protocols 7–9).

Journal: Current protocols in molecular biology

Article Title: Generating Single Cell-Derived Knockout Clones in Mammalian Cells with CRISPR/Cas9.

doi: 10.1002/cpmb.100

Figure Lengend Snippet: Figure 1 Schematic outline of the knockout process. The procedure includes (1) choosing a knockout strategy; (2) selecting gRNA target sites and performing vector cloning (Support Pro- tocols 1–3, Basic Protocol 1); (3) introducing CRISPR plasmids by transfection or transduction (Basic Protocols 2–5); (4) isolation and expansion of single-cell clones (Basic Protocol 6, Alternate Protocol 1); and (5) knockout verification by western blot analysis, PCR, and/or Sanger sequencing (Support Protocol 4, Basic Protocols 7–9).

Article Snippet: HEK293T cells (ATCC CRL-3216) CRISPR plasmid DNA (“all-in-one” plasmid or gRNA/Cas9 plasmids from Basic Protocol 1) psPAX2.0 plasmid (Addgene plasmid no. 12260) VSVG plasmid (Addgene plasmid no. 12259) 2 M CaCl2 Solution B (2× HEPES-buffered saline; see recipe).

Techniques: Knock-Out, Plasmid Preparation, Cloning, CRISPR, Transfection, Transduction, Isolation, Clone Assay, Western Blot, Sequencing

KEY RESOURCES TABLE

Journal: Cell

Article Title: Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma

doi: 10.1016/j.cell.2020.03.062

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Davis (University of Wisconsin) N/A Mouse: Kras LSL-G12D : B6.129S4- Kras tm4Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008179, RRID:IMSR_JAX:008179 Mouse: p53 KO/WT :129- Trp53 tm1Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:002080, RRID:IMSR_JAX:002080 Mouse: p53 R172H/WT : 129S-Trp53 tm2Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008652, RRID:IMSR_JAX:008652 Mouse: Kras LA2 :129S/Sv- Kras tm3Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008185, RRID:IMSR_JAX:008185 Mouse: C57BL/6J : C57/B6 Jackson Laboratories IMSR Cat# JAX:000664, RRID:IMSR_JAX:000664 Oligonucleotides Leptin cDNA Reverse Koch Institute Swanson Biotechnology Center TCAGCATTCAGGGCTAACATCCAACT mLepR sgRNA Forward Keck Biotechnology Center at Yale CACCGTGAAAGCCACCAGACCTCGA mLepR sgRNA Reverse Keck Biotechnology Center at Yale AAACTCGAGGTCTGGTGGCTTTCAC mLepR Target Site Forward Keck Biotechnology Center at Yale GGTTCTCAGTGCACGCATTT mLepR Target Site Reverse Keck Biotechnology Center at Yale ACAACGATTTTCCTGGCATCT Leptin cDNA Forward Koch Institute Swanson Biotechnology Center ATGTGCTGGAGACCCCTGT Recombinant DNA lentiGuide-puro Addgene Cat# 52963 lentiCas9-blast Addgene Cat# 52962 pFBAAVCAGmcsBgHpa University of Iowa Viral Vector Core Cat# G0345 psPAX2 Addgene Cat# 12259 pCMV-VSV-G Addgene Cat# 8454 Software and Algorithms ImageJ NIH N/A QuPath v0.1.2 Github N/A Prism v8.0 Graphpad N/A Image Studio Lite LI-COR N/A PHATE https://github.com/KrishnaswamyLab/PHATE N/A MAGIC https://github.com/KrishnaswamyLab/MAGIC N/A FASTX-toolkit Greg Hannon lab ( http://hannonlab.cshl.edu/fastx_toolkit ) N/A Burrows-Wheeler Aligner v0.5.5 Source Forge N/A Picard toolkit v1.21 Github N/A GATK v.1.0.5538 Broad Institute N/A ANNOVAR http://annovar.openbioinformatics.org/ N/A RSEM v.1.2.12 Dewey lab/Github N/A Cytoscape v.3.3.0 Cytoscape Consortium N/A Cell Ranger 10X Genomics N/A SAS v9.4 SAS Institute, Inc. N/A MELD https://github.com/KrishnaswamyLab/MELD N/A diffxpy https://github.com/theislab/diffxpy/ N/A R package JADE https://www.rdocumentation.org/packages/JADE/versions/1.1-0 N/A Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Plasmid Preparation, Generated, Transplantation Assay, Recombinant, DNA Extraction, Lysis, Extraction, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Viability Assay, Reverse Transcription, Bicinchoninic Acid Protein Assay, Picogreen Assay, Derivative Assay, Software

Figure 4. Use of activating transcription factor 4 (ATF4) knockout cells and a rapamycin-resistant ATF4 to validate ATF4 targets regulated by mechanistic target of rapamycin complex 1 signaling. (A) Schematic of ATF4 transcript, including upstream open reading frames (uORFs), coding sequence (CDS), and DNA-binding domain (DNABD), highlighting location of CRISPRn guides biallelic location of ATF4 mutations generated in Tsc2-/-

Journal: eLife

Article Title: The mTORC1-mediated activation of ATF4 promotes protein and glutathione synthesis downstream of growth signals

doi: 10.7554/elife.63326

Figure Lengend Snippet: Figure 4. Use of activating transcription factor 4 (ATF4) knockout cells and a rapamycin-resistant ATF4 to validate ATF4 targets regulated by mechanistic target of rapamycin complex 1 signaling. (A) Schematic of ATF4 transcript, including upstream open reading frames (uORFs), coding sequence (CDS), and DNA-binding domain (DNABD), highlighting location of CRISPRn guides biallelic location of ATF4 mutations generated in Tsc2-/-

Article Snippet: DOI: https://doi.org/10.7554/eLife.63326 19 of 33 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Transfected construct (mouse) siAtf4 GE Life Sciences/ Dharmacon L-042737-01-0020 Transfected construct (mouse) siRheb GE Life Sciences/ Dharmacon L-057044-00-0020 Transfected construct (mouse) siRhebL1 GE Life Sciences/ Dharmacon L-056074-01-0020 Transfected construct (mouse) siTsc2 GE Life Sciences/ Dharmacon L-047050-00-0020 Transfected construct (mouse) siC/ebpa GE Life Sciences/ Dharmacon L-040561-00-0005 Transfected construct (mouse) siC/ebpb GE Life Sciences/ Dharmacon L-043110-00-0005 Transfected construct (mouse) siC/ebpd GE Life Sciences/ Dharmacon L-060294-01-0005 Transfected construct (mouse) siC/ebpg GE Life Sciences/ Dharmacon L-065627-00-0005 Transfected construct (human) siATF4 GE Life Sciences/ Dharmacon L-005125-00-0020 Sequenced-based reagent qPCR primers IDT See table in Materials and methods Recombinant DNA reagent ATF4 (cDNA amplified from plasmid) Addgene RRID:Addgene_21845 Recombinant DNA reagent Pspax2 (plasmid) Addgene RRID:Addgene_12260 Recombinant DNA reagent Pmd2.G (plasmid) Addgene RRID:Addgene_12259 Recombinant DNA reagent pSpCas9n(BB) 2A-GFP (PX461) (plasmid) Addgene RRID:Addgene_48140 Recombinant DNA reagent pTRIPZ (plasmid) PMID:27088857 Alex Toker (Beth Israel Deaconess Medical Center) Recombinant DNA reagent GFP (cDNA amplified from plasmid) Addgene RRID:Addgene_19319 Recombinant DNA reagent SLC7A11 (cDNA amplified from plasmid) PMID:29259101 Alex Toker (Beth Israel Deaconess Medical Center) Recombinant DNA reagent pBabe hygro IRES-TSC2 PMID:15150095 David Kwiatkowski (Brigham and Women’s Hospital) Sequenced-based reagent CRISPR-Cas9n guides for KO of ATF4 IDT CACCGGAGG TGGAGGGGCTATGCT; AAACAGCATAGCCCC TCCACCTCC; CACCGACAATCTGCCTTC TCCAGG; AAACCC TGGAGAAGGCAGATTG TC Sequenced-based reagent Sequencing primers for Atf4-/- cell lines IDT TCGATGCTCTGTTTCGAA TG; CTTCTTCCCCC TTGCCTTAC Continued on next page Torrence et al. eLife 2021;10:e63326.

Techniques: Knock-Out, Sequencing, Binding Assay, Generated

Figure 5. Activation of activating transcription factor 4 (ATF4) contributes to the induction of protein synthesis downstream of mechanistic target of rapamycin complex 1. (A, B) Representative autoradiogram and immunoblot of wild-type (WT) and Tsc2-/- mouse embryo fibroblasts (MEFs) transfected with siRNAs targeting Atf4 or Rheb1 and Rhebl1 or non-targeting controls (siCT) and serum-deprived for 16 hr with a pulse label of [35S]-methionine for the final 20 min (A) and quantified in (B). Biological triplicates from a representative experiment are shown in (A). (B) is graphed as mean ± SEM from Figure 5 continued on next page

Journal: eLife

Article Title: The mTORC1-mediated activation of ATF4 promotes protein and glutathione synthesis downstream of growth signals

doi: 10.7554/elife.63326

Figure Lengend Snippet: Figure 5. Activation of activating transcription factor 4 (ATF4) contributes to the induction of protein synthesis downstream of mechanistic target of rapamycin complex 1. (A, B) Representative autoradiogram and immunoblot of wild-type (WT) and Tsc2-/- mouse embryo fibroblasts (MEFs) transfected with siRNAs targeting Atf4 or Rheb1 and Rhebl1 or non-targeting controls (siCT) and serum-deprived for 16 hr with a pulse label of [35S]-methionine for the final 20 min (A) and quantified in (B). Biological triplicates from a representative experiment are shown in (A). (B) is graphed as mean ± SEM from Figure 5 continued on next page

Article Snippet: DOI: https://doi.org/10.7554/eLife.63326 19 of 33 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Transfected construct (mouse) siAtf4 GE Life Sciences/ Dharmacon L-042737-01-0020 Transfected construct (mouse) siRheb GE Life Sciences/ Dharmacon L-057044-00-0020 Transfected construct (mouse) siRhebL1 GE Life Sciences/ Dharmacon L-056074-01-0020 Transfected construct (mouse) siTsc2 GE Life Sciences/ Dharmacon L-047050-00-0020 Transfected construct (mouse) siC/ebpa GE Life Sciences/ Dharmacon L-040561-00-0005 Transfected construct (mouse) siC/ebpb GE Life Sciences/ Dharmacon L-043110-00-0005 Transfected construct (mouse) siC/ebpd GE Life Sciences/ Dharmacon L-060294-01-0005 Transfected construct (mouse) siC/ebpg GE Life Sciences/ Dharmacon L-065627-00-0005 Transfected construct (human) siATF4 GE Life Sciences/ Dharmacon L-005125-00-0020 Sequenced-based reagent qPCR primers IDT See table in Materials and methods Recombinant DNA reagent ATF4 (cDNA amplified from plasmid) Addgene RRID:Addgene_21845 Recombinant DNA reagent Pspax2 (plasmid) Addgene RRID:Addgene_12260 Recombinant DNA reagent Pmd2.G (plasmid) Addgene RRID:Addgene_12259 Recombinant DNA reagent pSpCas9n(BB) 2A-GFP (PX461) (plasmid) Addgene RRID:Addgene_48140 Recombinant DNA reagent pTRIPZ (plasmid) PMID:27088857 Alex Toker (Beth Israel Deaconess Medical Center) Recombinant DNA reagent GFP (cDNA amplified from plasmid) Addgene RRID:Addgene_19319 Recombinant DNA reagent SLC7A11 (cDNA amplified from plasmid) PMID:29259101 Alex Toker (Beth Israel Deaconess Medical Center) Recombinant DNA reagent pBabe hygro IRES-TSC2 PMID:15150095 David Kwiatkowski (Brigham and Women’s Hospital) Sequenced-based reagent CRISPR-Cas9n guides for KO of ATF4 IDT CACCGGAGG TGGAGGGGCTATGCT; AAACAGCATAGCCCC TCCACCTCC; CACCGACAATCTGCCTTC TCCAGG; AAACCC TGGAGAAGGCAGATTG TC Sequenced-based reagent Sequencing primers for Atf4-/- cell lines IDT TCGATGCTCTGTTTCGAA TG; CTTCTTCCCCC TTGCCTTAC Continued on next page Torrence et al. eLife 2021;10:e63326.

Techniques: Activation Assay, Western Blot, Transfection